Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU080971

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTATGGAGCAAGTTCTGCAGATGGTTCCAGAGACGGGAGTCCTGGGCCCAGAGCCGAGATGAGCAGAACCTGCTGCAGCAGAAGAGGATCTGGGAGTCTCCTCTCCTTCTAGCTGCCAAAGATAATGATGTCCAGGCCCTGAACAAGTTGCTCAAGTATGAGGATTGCAAGGTGCACCAGAGAGGAGCCATGGGGGAAACAGCGCTACACATAGCAGCCCTCTATGACAACCTGGAGGCCGCCATGGTGCTGATGGAGGCTGCCCCGGAGCTGGTCTTTGAGCCCATGACATCTGAGCTCTATGAGGGTCAGACTGCACTGCACATCGCTGTTGTGAACCAGAACATGAACCTGGTGCGAGCCCTGCTTGCCCGCAGGGCCAGTGTCTCTGCCAGAGCCACAGGCACTGCCTTCCGCCGTAGTCCCTGCAACCTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

M Skrzypski et al.
Biochimica et biophysica acta, 1853(12), 3202-3210 (2015-09-20)
Transient receptor potential channel vanilloid type 6 (TRPV6) is a non-selective cation channel with high permeability for Ca²⁺ ions. So far, the role of TRPV6 in pancreatic beta cells is unknown. In the present study, we characterized the role of
Cuiping Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1695-1709 (2018-12-07)
Parathyroid hormone-related protein (PTHrP) is implicated in regulating calcium homeostasis in vertebrates, including sea bream, chick, and mammals. However, the molecular mechanism underlying the function of PTHrP in regulating calcium transport is still not fully investigated. This study aimed to
Shigenori Miura et al.
Nature communications, 6, 8871-8871 (2015-11-14)
Microvilli are cellular membrane protrusions present on differentiated epithelial cells, which can sense and interact with the surrounding fluid environment. Biochemical and genetic approaches have identified a set of factors involved in microvilli formation; however, the underlying extrinsic regulatory mechanism
H Bond et al.
The Journal of physiology, 586(7), 2015-2025 (2008-02-09)
The role of parathyroid hormone-related protein (PTHrP) in fetal calcium homeostasis and placental calcium transport was examined in mice homozygous for the deletion of the PTHrP gene (PTHrP-/- null; NL) compared to PTHrP+/+ (wild-type; WT) and PTHrP+/- (heterozygous; HZ) littermates.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service