Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU079551

Sigma-Aldrich

MISSION® esiRNA

targeting human PATJ

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCACTGAAACCACCAGCTCTCTTTCTAACTGGAGCAGTGGAAACTGAAACTAATGTGGATGGTGAAGATGAGGAAATTAAAGAAAGAATTGATACTTTAAAAAATGACAACATACAAGCCTTAGAAAAATTGGAAAAAGTCCCAGACTCTCCAGAAAATGAGCTGAAATCCAGATGGGAAAACCTGTTGGGTCCTGATTATGAAGTAATGGTTGCTACTTTGGACACACAGATTGCAGATGATGCTGAGTTACAGAAATATTCAAAGCTGCTGCCTATTCACACTCTGAGGCTTGGTGTGGAAGTGGATTCCTTTGATGGGCACCATTATATTTCTTCAATTGTTTCTGGTGGTCCTGTTGATACATTGGGTCTCCTACAGCCAGAAGATGAGCTGCTTGAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pingping Li et al.
Frontiers in genetics, 11, 931-931 (2020-10-03)
Introduction: The Pals1-associated tight junction (PATJ) is a Crumbs (CRB) complex component that regulates epithelial cell apico-basal polarity and directional migration. This study assessed PATJ expression in clear cell renal cell carcinoma (ccRCC) vs. normal tissues and associated with ccRCC
Arthur Marivin et al.
Molecular biology of the cell, 30(16), 1900-1910 (2019-07-04)
Dishevelled-Associating Protein with a high frequency of LEucines (DAPLE) belongs to a group of unconventional activators of heterotrimeric G-proteins that are cytoplasmic factors rather than membrane proteins of the G-protein-coupled receptor superfamily. During neurulation, DAPLE localizes to apical junctions of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service