Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU062331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3IP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGAAGAATTGCGGAAAGTCTTTATCACTTATTCGATGGACACAGCTATGGAGGTGGTGAAATTCGTGAACTTTTTGTTGGTAAATGGCTTCCAAACTGCAATTGACATATTTGAGGATAGAATCCGAGGCATTGATATCATTAAATGGATGGAGCGCTACCTTAGGGATAAGACCGTGATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAGCTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAGTTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAGAAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nitin A Das et al.
Journal of molecular and cellular cardiology, 121, 107-123 (2018-07-10)
Persistent inflammation promotes development and progression of heart failure (HF). TWEAK (TNF-Related WEAK Inducer Of Apoptosis), a NF-κB- and/or AP-1-responsive proinflammatory cytokine that signals via TWEAK receptor (TWEAKR), is expressed at high levels in human and preclinical models of HF.
Hongxue Sun et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 528-539 (2018-07-19)
This study investigated the role of the microRNA miR-298 and its target Act1 in ischemic stroke. Cell viability was assessed with the 3-(4,5-dimethythiazol-2- yl)-2,5-diphenyl tetrazolium bromide assay. Apoptotic cells were detected by flow cytometry, and mRNA and protein expression were
Hyo Jeong Kim et al.
Biochemical and biophysical research communications, 524(4), 1044-1050 (2020-02-19)
Bone homeostasis is maintained by concerted actions of bone-forming osteoblasts and bone-resorbing osteoclasts. A wide range of evidence indicates that a proinflammatory cytokine IL-17 promotes osteoclastogenesis. However, the role of IL-17 in osteoblasts is less well-understood. In the current study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service