Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU061031

Sigma-Aldrich

MISSION® esiRNA

targeting human SRPK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGTTGAAAGACCCTTGAAAGAGAACCCACCTAATAAAATGACCCAAGAAAAACTTGAAGAGTCAAGTACCATTGGCCAGGATCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAACTTCAAGAAAGCATTCGGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhengbu Liao et al.
Molecular neurobiology, 54(3), 1818-1824 (2016-02-19)
Up to now, the serine-arginine protein kinase 1 (SRPK1) has been suggested as an important signal mediator, which is implicated in the development of cancers. Unfortunately, some molecular pathways in SRPK1-mediated epithelial-mesenchymal transition (EMT) in human spinal glioblastoma have been
Parmanand Malvi et al.
Oncogenesis, 9(8), 77-77 (2020-08-30)
Triple-negative breast cancer (TNBC) is a highly metastatic breast cancer subtype and due to the lack of hormone receptors and HER2 expression, TNBC has limited therapeutic options with chemotherapy being the primary choice for systemic therapy. LIM Domain Kinase 2
M V Gammons et al.
British journal of cancer, 111(3), 477-485 (2014-07-11)
Current therapies for metastatic melanoma are targeted either at cancer mutations driving growth (e.g., vemurafenib) or immune-based therapies (e.g., ipilimumab). Tumour progression also requires angiogenesis, which is regulated by VEGF-A, itself alternatively spliced to form two families of isoforms, pro-

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service