Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU058281

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAAAGCTGGGGGATAGAGGGGCTGCAGGGCCACTGGAAGGAACATGGAGCTGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 688-692 (2018-03-28)
IGFBP6 gene plays an important role in the pathogenesis of breast cancer. In this work, we performed knockdown of IGFBP6 gene in MDA-MB-231 cells and obtained a stable cell line. Knockdown of IGFBP6 gene was confirmed by the real-time PCR.
S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 650-654 (2018-03-27)
Protein IGFBP6 plays an important role in the pathogenesis of many malignant tumors, including breast cancer. The relationship between IGFBP6 protein and the expression of genes associated with the epithelial-mesenchymal transition is studied. Gene IGFBP6 knockdown does not trigger the
Song Wang et al.
Neurochemical research, 42(2), 455-467 (2016-11-27)
IGFBP6, a member of the insulin-like growth factor-binding proteins family that contains six high affinity IGFBPs, modulates insulin-like growth factor (IGF) activity and also showed an independent effect of IGF, such as growth inhibition and apoptosis. However, the role of
Zhecun Wang et al.
Journal of cellular physiology, 235(12), 9538-9556 (2020-06-13)
Despite the high prevalence of varicose veins, the underlying pathogenesis of this disease remains unclear. The present study aims to explore the role of insulin-like growth factor binding protein 6 (IGFBP6) in vascular smooth muscle cells (VSMCs). Using a protein
Keigo Sawada et al.
Biochemical and biophysical research communications, 464(1), 299-305 (2015-06-28)
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service