Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU053361

Sigma-Aldrich

MISSION® esiRNA

targeting human ADORA2B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alisha Wehdnesday Bernardo Reyes et al.
Veterinary microbiology, 242, 108586-108586 (2020-03-04)
Brucella as a stealthy intracellular pathogen avoids activation of innate immune response. Here we investigated the contribution of an adenosine receptor, Adora2b, during Brucella infection in professional phagocyte RAW 264.7 cells and in a murine model. Adora2b-deficient cells showed attenuated
Max Wilkat et al.
International journal of cancer, 147(1), 202-217 (2019-12-18)
Adenosine is a signaling molecule that exerts dual effects on tumor growth: while it inhibits immune cell function and thereby prevents surveillance by the immune system, it influences tumorigenesis directly via activation of adenosine receptors on tumor cells at the
J S Long et al.
Oncogene, 34(40), 5152-5162 (2015-02-11)
Tumour cells often acquire the ability to escape cell death, a key event leading to the development of cancer. In almost half of all human cancers, the capability to induce cell death is reduced by the mutation and inactivation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service