Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU050111

Sigma-Aldrich

MISSION® esiRNA

targeting human PBK

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$292.00
50 μG
$534.00

$292.00

Please contact Customer Service for Availability
All Photos(1)

Select a Size

Change View
20 μG
$292.00
50 μG
$534.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$292.00

Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA

Ensembl | human accession no.

ENSG00000168078

NCBI accession no.

NM_018492

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PBK(55872) , PBK(55872)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
JUU
NRR
RPR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
Young-Ju Lee et al.
Biochemical and biophysical research communications, 522(1), 270-277 (2019-11-24)
TOPK has been suggested to contribute to invasion of lung, prostate, gastric, pancreatic or breast cancer cells. However, how TOPK mediates TGF-β1/Smad signaling leading to epithelial-mesenchymal transition (EMT) and invasion of breast cancer cells remains unknown. Here we report that
Young-Ju Lee et al.
Biochemical and biophysical research communications, 530(1), 122-129 (2020-08-24)
TGF-β1 is known to induce epithelial-mesenchymal transition (EMT), which is a prerequisite for cancer cell invasion. Here we reveal that TOPK upregulates EMT and invasion of human breast cancer MDA-MB-231 or Hs578T cells via NF-κB-dependent Snail/Slug in TGF-β1 signaling. Endogenous
Seth Stauffer et al.
Cellular signalling, 39, 74-83 (2017-08-07)
PDZ-binding kinase (PBK) plays a major role in proliferation and in safeguarding mitotic fidelity in cancer cells. Frequently upregulated in many cancers, PBK drives tumorigenesis and metastasis. PBK has been shown to be phosphorylated in mitosis by cyclin-dependent kinase 1
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service