Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU049601

Sigma-Aldrich

MISSION® esiRNA

targeting human FA2H

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTTCATGCTGGGGACATTCCTCTGGAGCCTCATCGAGTACCTCATCCACCGCTTCCTGTTCCACATGAAGCCCCCCAGCGACAGCTATTACCTCATCATGCTGCACTTCGTCATGCACGGCCAGCACCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCCCCTGTGCCAGCCTCCCTGGTGATCGGCGTCTTCTACTTGTGCATGCAGCTCATCCTGCCCGAGGCAGTAGGGGGCACTGTGTTTGCGGGGGGCCTCCTGGGCTACGTCCTCTATGACATGACCCATTACTACCTGCACTTTGGCTCGCCGCACAAGGGCTCCTACCTGTACAGCCTGAAGGCCCACCACGTCAAGCACCACTTTGCACATCAGAAGTCAGGATTTGGTATCAGCACTAAATTGTGGGATTACTGTTTCCACACCCTCACTCCAGAGAAACCCCACCT

Ensembl | human accession no.

ENSG00000103089

NCBI accession no.

NM_024306

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FA2H(79152) , FA2H(79152)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Masayo Hirao-Suzuki et al.
Biochemical and biophysical research communications, 531(2), 215-222 (2020-08-17)
The functional role of fatty acid 2-hydroxylase (FA2H) is controversial in the field of cancer biology due to the dual role of FA2H, particularly related to its interaction with triple-negative breast cancer (TNBC). A previous biochemical- and clinical-focused study suggested
Bo Hong et al.
Open medicine (Warsaw, Poland), 15(1), 882-889 (2020-12-22)
MicroRNA (miR/miRNA) expression disorders play a crucial role in the development of gastric cancer (GC). Increasing evidence has indicated that miRNAs participate in the process of numerous cancers. Previous research has demonstrated that miR-300 acts as a cancer-promoting factor or
Bishuang Gong et al.
Molecular immunology, 122, 173-185 (2020-05-07)
Thymic epithelial cells (TECs) are essential regulators of T cell development and selection. microRNAs (miRNAs) play critical roles in regulating TECs proliferation during thymus involution. miR-205-5p is highly expressed in TECs and increases with age. However, the function and potential
Janani Ravi et al.
Oncotarget, 5(9), 2475-2486 (2014-05-09)
The endocannabinoid anandamide (AEA), a neurotransmitter was shown to have anti-cancer effects. Fatty acid amide hydrolase (FAAH) metabolizes AEA and decreases its anti-tumorigenic activity. In this study, we have analyzed the role of FAAH inhibition in non-small cell lung cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service