Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU034751

Sigma-Aldrich

MISSION® esiRNA

targeting human XPO1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$303.00
50 μG
$571.00

$303.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$303.00
50 μG
$571.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$303.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAACTAAAGCAGATGCTTCCTTTAAATACCAATATTCGACTTGCGTACTCAAATGGAAAAGATGATGAACAGAACTTCATTCAAAATCTCAGTTTGTTTCTCTGCACCTTTCTTAAGGAACATGATCAACTTATAGAAAAAAGATTAAATCTCAGGGAAACTCTTATGGAGGCCCTTCATTATATGTTGTTGGTATCTGAAGTAGAAGAAACTGAAATCTTTAAAATTTGTCTTGAATACTGGAATCATTTGGCTGCTGAACTCTATAGAGAGAGTCCATTCTCTACATCTGCCTCTCCGTTGCTTTCTGGAAGTCAACATTTTGATGTTCCTCCCAGGAGACAGCTATATTTGCCCATGTTATTCAAGGTCCGTTTATTAATGGTTAGTCGAATGGCTAAACCAGAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Asfar S Azmi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(6), 1338-1348 (2019-12-14)
Pancreatic ductal adenocarcinoma (PDAC) remains a deadly disease urgently requiring new treatments. Overexpression of the protein transporter exportin-1 (XPO1) leads to mislocalization of tumor-suppressor proteins (TSP) and their inactivation. Earlier, we showed that blocking XPO1 by CRISPR/Cas9 validated Selective Inhibitor
Xiaojing Yang et al.
Medical oncology (Northwood, London, England), 31(9), 155-155 (2014-08-26)
Chromosome region maintenance 1 (CRM1) has been related to several malignancies. The predictive value of CRM1 in the malignance and prognosis of esophageal squamous cell carcinoma (ESCC), however, is not clear yet. In this study, we displayed that CRM1 expression

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service