Skip to Content
MilliporeSigma
All Photos(2)

Documents

EHU032581

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCAAACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGTGAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACAAGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTTCAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGACCTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGTTCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Meei-Ling Sheu et al.
Oncotarget, 8(12), 19376-19388 (2016-12-31)
Ochratoxin A (OTA) contaminated food increases reactive oxygen species (ROS) production in glomerulus and causes glomerulopathy. The molecular mechanisms still remain uncertain. In this study, we used mouse and rat glomerular mesangial cells and delineate the signaling pathway behind the
L M Yu et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(7), 924-932 (2018-12-20)
Pancreatic cancer (PC) is a highly aggressive and metastatic disease, with an elevated mortality rate. It is, therefore, crucial to assess factors affecting the prognosis of PC patients. Meanwhile, calpain-1 is associated with malignant tumor progression and metastasis. Thus, it
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service