Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU030601

Sigma-Aldrich

MISSION® esiRNA

targeting human FOSL1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$303.00
50 μG
$571.00

$303.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$303.00
50 μG
$571.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$303.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCACACCCTCCCTAACTCCTTTCACCCCCAGCCTGGTCTTCACCTACCCCAGCACTCCTGAGCCTTGTGCCTCAGCTCATCGCAAGAGTAGCAGCAGCAGCGGAGACCCATCCTCTGACCCCCTTGGCTCTCCAACCCTCCTCGCTTTGTGAGGCGCCTGAGCCCTACTCCCTGCAGATGCCACCCTAGCCAATGTCTCCTCCCCTTCCCCCACCGGTCCAGCTGGCCTGGACAGTATCCCACATCCAACTCCAGCAACTTCTTCTCCATCCCTCTAATGAGACTGACCATATTGTGCTTCACAGTAGAGCCAGCTTGGGGCCACCAAAGCTGCCCACTGTTTCTCTTGAGCTGGCCTCTCTAGCACAATTTGCACTAAATCAGAGACAAAATATTTCCCATTTGTGCCAGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xide Xu et al.
Metabolic brain disease, 33(1), 115-125 (2017-10-29)
Neuronal apoptosis is an important process of secondary brain injury which is induced by neurochemical signaling cascades after traumatic brain injury (TBI). Present study was designed to investigate whether FOS-like antigen 1 (Fra-1) is involved in the neuronal apoptosis. Western
Vaibhav Sahai et al.
Molecular cancer therapeutics, 13(7), 1907-1917 (2014-05-09)
Pancreatic ductal adenocarcinoma (PDAC) is associated with pronounced fibrosis that contributes to chemoresistance, in part, through increased histone acetylation. Because bromodomain (BRD) and extra terminal domain (BET) proteins are "readers" of histone acetylation marks, we targeted BET proteins in PDAC
Jisun Lim et al.
Science advances, 6(16), eaba1334-eaba1334 (2020-06-04)
Glutathione (GSH), the most abundant nonprotein thiol functioning as an antioxidant, plays critical roles in maintaining the core functions of mesenchymal stem cells (MSCs), which are used as a cellular immunotherapy for graft-versus-host disease (GVHD). However, the role of GSH

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service