Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU029901

Sigma-Aldrich

MISSION® esiRNA

targeting human GNB4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTGATGACCTGTGCTTATGCTCCCTCTGGTAATTATGTTGCCTGTGGAGGCTTGGACAACATCTGCTCTATATATAACTTAAAGACCAGAGAGGGAAATGTGAGAGTAAGCCGAGAGTTGCCAGGTCACACAGGGTACTTGTCCTGCTGTCGTTTTTTAGATGACAGCCAAATTGTTACAAGTTCAGGAGATACAACTTGTGCTTTATGGGACATCGAAACTGCCCAGCAGACCACCACATTCACTGGGCATTCTGGAGATGTGATGAGTCTTTCTTTGAGTCCTGACATGAGGACTTTTGTTTCTGGTGCTTGTGATGCCTCTTCCAAATTATGGGATATTCGAGATGGAATGTGTAGACAGTCTTTCACGGGACATGTCTCAGATATCAATGCTGTCAGTTTTTTCCCAAATGGATATGCCTTCGCCACTGGCTCTGATGATGCCACTTGCCGGCTCTTTGACCTTCGTGCAGATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Wang et al.
BMC cancer, 18(1), 817-817 (2018-08-15)
Breast cancer is the most common malignancy in women worldwide. Although the endocrine therapy that targets estrogen receptor α (ERα) signaling has been well established as an effective adjuvant treatment for patients with ERα-positive breast cancers, long-term exposure may eventually
Jianpeng Gao et al.
Acta biochimica et biophysica Sinica, 52(9), 975-987 (2020-08-05)
Gastric cancer (GC) is one of the most common and lethal malignancies worldwide, and its poor prognosis is mainly due to the rapid tumor progression including tumor invasion, distant metastasis, etc. Understanding the molecular mechanisms regulating GC progression lays the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service