Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU025411

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH13

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAGTTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAGAACACAGGGAGCGTCTC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuya Fujishima et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1571-1583 (2017-01-08)
Adiponectin, an adipocyte-derived protein abundant in the circulation, is thought to be protective against atherosclerosis. However, it is not fully understood how the association of adiponectin with vascular cells and its antiatherogenic effect are connected. In this study, T-cadherin was
Yuri Tsugawa-Shimizu et al.
American journal of physiology. Endocrinology and metabolism, 320(2), E179-E190 (2020-12-08)
Adiponectin (APN) is a circulating protein specifically produced by adipocytes. Native APN specifically binds to T-cadherin, a glycosylphosphatidylinositol-anchored protein, mediating the exosome-stimulating effects of APN in endothelial, muscle, and mesenchymal stem cells. It was previously reported that APN has beneficial
Keisuke Matsuda et al.
Endocrinology, 156(3), 934-946 (2014-12-17)
Adiponectin (Adipo), a multimeric adipocyte-secreted protein abundant in the circulation, is implicated in cardiovascular protective functions. Recent work documented that Adipo locally associates with responsive tissues through interactions with T-cadherin (Tcad), an atypical, glycosylphosphatidylinositol (GPI)-anchored cadherin cell surface glycoprotein. Mice
Yuki Fujita et al.
Cell reports, 31(4), 107580-107580 (2020-04-30)
Microglia, the resident immune cells of the central nervous system, accumulate along subcerebral projection axons and support neuronal survival during the early postnatal period. It remains unknown how microglia follow an axon-specific distribution pattern to maintain neural circuits. Here, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service