Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU014011

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGTGCTGGAGATCATTGCCTTTCATTGCAAGAGCCCGCACCGACACCGAATGGTCGTTTTGGAGCCCCTGAACAAACTGCTGCAGGCGAAATGGGATCTGCTCATCCCCAAGTTCTTCTTAAACTTCCTGTGTAATCTGATCTACATGTTCATCTTCACCGCTGTTGCCTACCATCAGCCTACCCTGAAGAAGGGCGCCGCCCCTCACCTGAAAGCGGAGGTTGGAAACTCCATGCTGCTGACGGGCCACATCCTTATCCTGCTAGGGGGGATCTACCTCCTCGTGGGCCAGCTGTGGTACTTCTGGCGGCGCCACGTGTTCATCTGGATCTCGTTCATAGACAGCTACTTTGAAATCCTCTTCCTGTTCCAGGCCCTGCTCACAGTGGTGTCCCAGGTGCTGTGTTTCCTGGCCATCGAGTGGTACCTGCCCCTGCTTGTGTCTGCGCTGGTGCTGGGCTGGCTGAACCTGCTTTACTATACACGTGGCTTCCAGCACACAGGCATCTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Agathe Oulidi et al.
PloS one, 8(5), e64885-e64885 (2013-06-07)
Adrenomedullin (AM) is a 52-amino acid peptide initially isolated from human pheochromocytoma. AM is expressed in a variety of malignant tissues and cancer cell lines and was shown to be a mitogenic factor capable of stimulating growth of several cancer
Taro Ishii et al.
Journal of dermatological science, 90(3), 332-342 (2018-04-04)
Keratinocytes release several factors that are involved in wound contracture and scar formation. We previously reported that a three-dimensional reconstruction model derived from rat skin represents a good wound healing model. We characterized the role of transient receptor potential (TRP)
Michal Entin-Meer et al.
PloS one, 9(8), e105055-e105055 (2014-08-20)
A novel family of transient receptor potential (TRP) channels, that may hold a role in calcium homeostasis, has recently been described. By employing a GeneChip array analysis we have demonstrated a clear and specific upregulation of the TRP vanilloid 2
Matthew R Cohen et al.
PloS one, 8(12), e85392-e85392 (2014-01-07)
Transient receptor potential vanilloid 2 (TRPV2) is a Ca(2+)-permeable nonselective cation channel proposed to play a critical role in a wide array of cellular processes. Although TRPV2 surface expression was originally determined to be sensitive to growth factor signaling, regulated
Toshiaki Sawatani et al.
American journal of physiology. Cell physiology, 316(3), C434-C443 (2019-01-17)
β-Cell swelling induces membrane depolarization, which has been suggested to be caused at least partly by the activation of cation channels. Here, we show the identification of the cation channels. In isolated mouse pancreatic β-cells, the exposure to 30% hypotonic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service