Skip to Content
Merck
All Photos(1)

Key Documents

EHU047831

Sigma-Aldrich

MISSION® esiRNA

targeting human DDR2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCCTAATTCTTCCTCCAGCGATGTACGCACTGTCAGTTACACCAATCTGAAGTTTATGGCTACCCAAATTGCCTCTGGCATGAAGTACCTTTCCTCTCTTAATTTTGTTCACCGAGATCTGGCCACACGAAACTGTTTAGTGGGTAAGAACTACACAATCAAGATAGCTGACTTTGGAATGAGCAGGAACCTGTACAGTGGTGACTATTACCGGATCCAGGGCCGGGCAGTGCTCCCTATCCGCTGGATGTCTTGGGAGAGTATCTTGCTGGGCAAGTTCACTACAGCAAGTGATGTGTGGGCCTTTGGGGTTACTTTGTGGGAGACTTTCACCTTTTGTCAAGAACAGCCCTATTCCCAGCTGTCAGATGAACAGGTTATTGAGAATACTGGAGAGTTCTTCCGAGACCAAGGGAGGCAGACTTACCTCCCTCAACCAGCCATTTGTCCTGAC

Ensembl | human accession no.

ENSG00000162733

NCBI accession no.

NM_006182

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DDR2(4921) , DDR2(4921)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Khairul Anam et al.
Stem cell research & therapy, 4(5), 112-112 (2014-01-11)
Knowing the repertoire of cell signaling receptors would provide pivotal insight into the developmental and regenerative capabilities of bone marrow cell (BMC)-derived hematopoietic stem/progenitor cells (HSPCs) and bone marrow mesenchymal stromal cells (BMMSCs). Murine HSPCs were enriched from fluorescence-activated cell
Shijing Jia et al.
American journal of respiratory cell and molecular biology, 59(3), 295-305 (2018-04-14)
Progressive fibrosis is a complication of many chronic diseases, and collectively, organ fibrosis is the leading cause of death in the United States. Fibrosis is characterized by accumulation of activated fibroblasts and excessive deposition of extracellular matrix proteins, especially type
Mereena George Ushakumary et al.
PloS one, 14(12), e0225911-e0225911 (2019-12-06)
Collagen accumulation and remodeling in the vascular wall is a cardinal feature of vascular fibrosis that exacerbates the complications of hypertension, aging, diabetes and atherosclerosis. With no specific therapy available to date, identification of mechanisms underlying vascular fibrogenesis is an
Binhui Xie et al.
Journal of experimental & clinical cancer research : CR, 34, 101-101 (2015-09-13)
Several studies have found that DDR2 is up-regulated in many tumor types and facilitates tumor progression. However, the role of DDR2 in hepatocellular carcinoma (HCC) progression and its downstream signaling pathways remain unclear. DDR2 expression was assessed in several cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service