Skip to Content
Merck
All Photos(1)

Documents

EHU043331

Sigma-Aldrich

MISSION® esiRNA

targeting human SUZ12

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGCAACAAACTGAAGCAAGAGATGACCTGCATTGCCCTTGGTGTACTCTGAACTGCCGCAAACTTTATAGTTTACTCAAGCATCTTAAACTCTGCCATAGCAGATTTATCTTCAACTATGTTTATCATCCAAAAGGTGCTAGGATAGATGTTTCTATCAATGAGTGTTATGATGGCTCCTATGCAGGAAATCCTCAGGATATTCATCGCCAACCTGGATTTGCTTTTAGTCGCAACGGACCAGTTAAGAGAACACCTATCACACATATTCTTGTGTGCAGGCCAAAACGAACAAAAGCAAGCATGTCTGAATTTCTTGAATCTGAAGATGGGGAAGTAGAACAGCAAAGAACATATAGTAGTGGCCACAATCGTCTGTATTTCCATAGTGATACCTGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGATGAAAAGGATCCTGAATGGC

Ensembl | human accession no.

ENSG00000178691

NCBI accession no.

NM_015355

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SUZ12(23512) , SUZ12(23512)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoli Wei et al.
Oncology letters, 18(2), 1607-1616 (2019-08-20)
Chemotherapy resistance is a major obstacle to the effective treatment of patients with gastric cancer (GC). Mounting evidence has indicated that the dysregulation of microRNAs (miRNAs) is associated with the sensitivity of cancer cells to chemotherapy. However, the mechanisms underlying
Young Hwa Soung et al.
Cancers, 12(8) (2020-08-14)
Triple-negative breast cancers (TNBCs) lack ER, PR and her2 receptors that are targets of common breast cancer therapies with poor prognosis due to their high rates of metastasis and chemoresistance. Based on our previous studies that epigenetic silencing of a
Lin Jin et al.
Cancer research, 77(20), 5464-5478 (2017-08-23)
NOTCH signaling exerts essential roles in normal and malignant intestinal physiology and the homeostasis of cancer stem-like cells (CSC), but the basis for this latter role remains obscure. The signaling scaffold protein STRAP is upregulated in several cancers, where it
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service