Skip to Content
Merck
All Photos(1)

Documents

EMU079511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atf4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCTGTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATATCTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAAGACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCGGAGTCCTACCTGGGCTCTCCCCAGCATAGCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGG

Ensembl | mouse accession no.

ENSMUSG00000042406

NCBI accession no.

NM_009716

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... ATF4(11911) , Atf4(11911)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
Enni Markkanen et al.
Nucleic acids research, 43(7), 3667-3679 (2015-03-25)
Genetic instability, provoked by exogenous mutagens, is well linked to initiation of cancer. However, even in unstressed cells, DNA undergoes a plethora of spontaneous alterations provoked by its inherent chemical instability and the intracellular milieu. Base excision repair (BER) is
Kyong-Jin Jung et al.
Oncotarget, 6(3), 1556-1568 (2015-01-19)
Carnosic acid is a phenolic diterpene from rosmarinus officinalis, and has multiple functions, such as anti-inflammatory, anti-viral, and anti-tumor activity. In this study, we examined whether carnosic acid could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Souvik Dey et al.
The Journal of clinical investigation, 125(7), 2592-2608 (2015-05-27)
The integrated stress response (ISR) is a critical mediator of cancer cell survival, and targeting the ISR inhibits tumor progression. Here, we have shown that activating transcription factor 4 (ATF4), a master transcriptional effector of the ISR, protects transformed cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service