Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU075291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myc

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCTCCACTCACCAGCACAACTACGCCGCACCCCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAGCAGATCAGCAACAACCGCAAGTGCTCCAGCCCCAGGTCCTCAGACACGGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGGAACGAGCTGAAGCGCAGCTTTTTTGCCCTGCGTGACCAGATCCCTGAATTGGAAAACAACGAAAAGGCCCCCAAGGTAGTGATCCTCAAAAAAGCCACCGCCTACATCCTGTCCATTCAAGCAGACGAGCACAAGCTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAAACTGACCTAACTCGAGGAGGAGCTGGA

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Naveen K Tangudu et al.
Molecular cancer therapeutics, 14(5), 1259-1269 (2015-02-20)
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge
Wen-Li Mu et al.
Stem cells (Dayton, Ohio), 33(7), 2135-2147 (2015-05-06)
Mouse somatic cells can be reprogrammed into induced pluripotent stem cells by defined factors known to regulate pluripotency, including Oct4, Sox2, Klf4, and c-Myc. Together with Oct4, Sox2 plays a major role as a master endogenous pluripotent genes trigger in
C M Lucas et al.
Leukemia, 29(7), 1514-1523 (2015-03-15)
High cancerous inhibitor of PP2A (CIP2A) protein levels at diagnosis of chronic myeloid leukaemia (CML) are predictive of disease progression in imatinib-treated patients. It is not known whether this is true in patients treated with second generation tyrosine kinase inhibitors
Kazunori Hamamura et al.
Cellular signalling, 26(11), 2358-2369 (2014-07-20)
Wnt signaling plays a major role in bone homeostasis and mechanotransduction, but its role and regulatory mechanism in osteoclast development are not fully understood. Through genome-wide in silico analysis, we examined Wnt3a-driven regulation of osteoclast development. Mouse bone marrow-derived cells
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica