Skip to Content
Merck
All Photos(1)

Key Documents

EMU021051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnfrsf10b

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCAGGCTCTTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAGTAGTTAGTGTATCATATTATTGTATTATTTATATTATTACTGTTAAGTACTATGTTCTCTTATTAGAAGTTGAACACAGAACCTCTGAGAACACATATGCTACAAGTGTTCTAACACACCTCCAGCATCCCGGATTACCTTTGTTCCTGAACAAGGCACAATTGGTAGGGTATGATAGGGCCTGCCTATCATCCTAACACTCCGGTGATGGAGCCAGGAAGATCAAGAGTTCGAGGCCAGCTGGTTCACATAAGATCCCATATAATGTGCAGGATGGCTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCCAGATTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hemn Mohammadpour et al.
Photodiagnosis and photodynamic therapy, 12(2), 238-243 (2015-02-28)
Mesenchymal stem cells are multi-potent progenitor cells that inhibit tumor growth by some ligands and releasing factors including TRAIL, DKK-1 and DKK-3. On other hands, photodynamic therapy is commonly used for treatment of different types of cancer. The aims of
Deokil Shin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1151-1162 (2015-06-27)
Although Vitisin A, derived from wine grapes, is known to have cytotoxic, anti-adipogenic, anti-inflammatory and antioxidant effects, the underlying antitumor mechanism has not been investigated in prostate cancer cells to date. In the present study, the apoptotic mechanism of Vitisin
Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize
Seon Min Woo et al.
Oncotarget, 6(13), 11614-11626 (2015-04-07)
FTY720, Fingolimod, is a functional antagonist to the sphingosine-1-phosphate (S1P) receptor and an inhibitor of sphingosine kinase 1. Here, we showed that a combination of FTY720 and TRAIL induced apoptosis in human renal, breast, and colon carcinoma cells. Most importantly
Jiahe Li et al.
Scientific reports, 5, 9987-9987 (2015-05-20)
Malignant transformation results in increased levels of reactive oxygen species (ROS). Adaption to this toxic stress allows cancer cells to proliferate. Recently, piperlongumine (PL), a natural alkaloid, was identified to exhibit novel anticancer effects by targeting ROS signaling. PL induces

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service