Skip to Content
Merck
All Photos(1)

Documents

EHU232231

Sigma-Aldrich

MISSION® esiRNA

targeting human IRGM

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAA

Ensembl | human accession no.

ENSG00000237693

NCBI accession no.

NM_001145805

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRGM(345611) , IRGM(345611)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Cheng Lin et al.
Journal of hepatology, 65(6), 1209-1216 (2016-07-16)
Autophagy has been shown to be crucial in the regulation of the intracellular lipid stores in hepatocytes. We hypothesize that immunity-related GTPase family M (IRGM) gene (an autophagy-related gene) variants confer the susceptibility to non-alcoholic fatty liver disease (NAFLD) development.
Chih-Peng Chang et al.
PloS one, 6(12), e28323-e28323 (2011-12-14)
Interferon-gamma (IFN-γ), a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A) can cause autophagic cell death in hepatocytes
Kautilya Kumar Jena et al.
EMBO reports, 21(9), e50051-e50051 (2020-07-28)
Activation of the type 1 interferon response is extensively connected to the pathogenesis of autoimmune diseases. Loss of function of Immunity Related GTPase M (IRGM) has also been associated to several autoimmune diseases, but its mechanism of action is unknown.
Xize Guo et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14768-14779 (2020-09-18)
Mitochondria is a double membrane-bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity-related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service