Skip to Content
Merck
All Photos(1)

Documents

EHU159431

Sigma-Aldrich

MISSION® esiRNA

targeting human USP9X

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTGCATCCAATGTTTACCTACAGTATATGAGAAATGGAGAGCTTCCAGCTGAACAGGCTATTCCGGTCTGTGGTTCACCACCTACAATTAATGCTGGTTTTGAATTACTTGTAGCATTAGCTGTTGGCTGTGTGAGGAATCTCAAACAAATAGTAGATTCTTTGACTGAAATGTATTACATTGGCACAGCAATAACTACTTGTGAAGCACTTACTGAGTGGGAATATCTGCCACCTGTTGGACCCCGCCCACCCAAAGGATTCGTGGGGCTGAAAAATGCCGGTGCTACTTGTTACATGAATTCTGTGATTCAGCAACTCTACATGATTCCTTCCATTAGGAACGGTATTCTTGCCATTGAAGGCACAGGTAGTGATGTAGATGATGATATGTCTGGGGATGAGAAGCA

Ensembl | human accession no.

ENSG00000124486

NCBI accession no.

NM_001039591

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... USP9X(8239) , USP9X(8239)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hua He et al.
ACS nano, 10(2), 1859-1870 (2016-01-27)
Treatment of inflammatory diseases represents one of the biggest clinical challenges. RNA interference (RNAi) against TNF-α provides a promising modality toward anti-inflammation therapy, but its therapeutic potential is greatly hampered by the by the lack of efficient siRNA delivery vehicles
Yu Xia et al.
International journal of nanomedicine, 13, 143-159 (2018-01-11)
Human homeobox protein (Nanog) is highly expressed in most cancer cells and has gradually emerged as an excellent target in cancer therapy, owing to its regulation of cancer cell proliferation, metastasis and apoptosis. In this study, we prepared tumor-targeting functionalized
Hui Peng et al.
The Journal of reproduction and development, 64(2), 173-177 (2018-02-13)
Fas-associated protein factor 1 (FAF1) is a Fas-associated protein that functions in multiple cellular processes. Previous research showed that mutations in Faf1 led to the lethality of cleavage stage embryos in a mouse model. The aim of the present study
Chenyang Li et al.
Pharmaceutical research, 37(6), 109-109 (2020-06-02)
Cancer-Immunity Cycle is a cascade of anticancer immune responses in the body that continues and fights against the cancer expansion. The Cancer-Immunity Cycle is halted by tumor cell immunosuppression of host T cell through programmed cell death receptor 1 (PD-1)
Juliana Santos Rosa Viegas et al.
Drug delivery and translational research, 10(3), 646-660 (2020-02-16)
Since psoriasis is an immuno-mediated skin disease, long-term therapies are necessary for its treatment. In clinical investigations, tacrolimus (TAC), a macrolide immunosuppressive inhibitor of calcineurin, arises as an alternative for the treatment of psoriasis, acting in some cytokines involved in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service