Skip to Content
Merck
All Photos(1)

Key Documents

EHU144761

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGCGGGTACGAATGCTATACTACCTGAGGCAGGAGGTTATTGGAGACCAAGCAGAAAAGGTGTTAGGGGGTGCGATTGCCAGTGAGATTGACATATGGTTCCCAGTAGTGGATCAACTGGAGGTTCCAACAACTTGGTGGGACAGTGAGGCTGACAAGTCGCTGCTCATTGGAGTCTTTAAACATGGCTATGAGAAATATAATACCATGAGGGCAGACCCAGCCTTATGTTTCCTAGAAAAGGCTGGCCGACCAGATGACAAAGCAATTGCAGCAGAACATCGAGTGTTGGATAACTTCTCTGACATAGTAGAAGGGGTTGACTTTGATAAAGATTGTGAAGATCCTGAATATAAACCACTCCAAGGTCCCCCAAAGGACCAAGATGATGAGGGTGATCCCTTGATGATGATGGATGAGGAGATCTCAGTGATTGATGGAGATGAAGCCCAGGTGACCCAACAGCCAGGCCATTTATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Justin Cotney et al.
Nature communications, 6, 6404-6404 (2015-03-11)
Recent studies implicate chromatin modifiers in autism spectrum disorder (ASD) through the identification of recurrent de novo loss of function mutations in affected individuals. ASD risk genes are co-expressed in human midfetal cortex, suggesting that ASD risk genes converge in
Chuntao Zhao et al.
Developmental cell, 45(6), 753-768 (2018-06-20)
Disruptive mutations in chromatin remodeler CHD8 cause autism spectrum disorders, exhibiting widespread white matter abnormalities; however, the underlying mechanisms remain elusive. We show that cell-type specific Chd8 deletion in oligodendrocyte progenitors, but not in neurons, results in myelination defects, revealing
María Ceballos-Chávez et al.
PLoS genetics, 11(4), e1005174-e1005174 (2015-04-22)
While the importance of gene enhancers in transcriptional regulation is well established, the mechanisms and the protein factors that determine enhancers activity have only recently begun to be unravelled. Recent studies have shown that progesterone receptor (PR) binds regions that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service