Skip to Content
Merck
All Photos(1)

Documents

EHU109221

Sigma-Aldrich

MISSION® esiRNA

targeting human TARDBP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seiichi Nagano et al.
Acta neuropathologica, 140(5), 695-713 (2020-08-18)
Mislocalization and abnormal deposition of TDP-43 into the cytoplasm (TDP-43 proteinopathy) is a hallmark in neurons of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the pathogenic mechanism of the diseases linked to TDP-43 is largely unknown. We
Xiaowei Chen et al.
Protein & cell, 9(10), 848-866 (2017-09-28)
Aberrant regulation of miRNA genes contributes to pathogenesis of a wide range of human diseases, including cancer. The TAR DNA binding protein 43 (TDP-43), a RNA/DNA binding protein associated with neurodegeneration, is involved in miRNA biogenesis. Here, we systematically examined
Michael E Ward et al.
The Journal of experimental medicine, 211(10), 1937-1945 (2014-08-27)
Frontotemporal dementia (FTD) is the most common cause of dementia in people under 60 yr of age and is pathologically associated with mislocalization of TAR DNA/RNA binding protein 43 (TDP-43) in approximately half of cases (FLTD-TDP). Mutations in the gene
Stephani A Davis et al.
Neurobiology of disease, 103, 154-162 (2017-04-19)
Although the main focus in Alzheimer's disease (AD) has been an investigation of mechanisms causing Aβ plaque deposition and tau tangle formation, recent studies have shown that phosphorylated TDP-43 pathology is present in up to 50% of sporadic cases. Furthermore
Pascual Torres et al.
Autophagy, 14(8), 1398-1403 (2018-06-19)
TARDBP (TAR DNA binding protein) is one of the components of neuronal aggregates in sporadic amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration. We have developed a simple quantitative method to evaluate TARDBP splicing function that was applied to spinal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service