Skip to Content
Merck
All Photos(1)

Documents

EHU102911

Sigma-Aldrich

MISSION® esiRNA

targeting human RACK1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTG

Ensembl | human accession no.

ENSG00000204628

NCBI accession no.

NM_006098

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RACK1(10399) , GNB2L1(10399)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yi Hu et al.
Cancer letters, 450, 144-154 (2019-03-09)
Receptor of activated protein kinase C 1 (RACK1) is downregulated in gastric cancer and is involved in modulating NF-κB signaling pathway activity. However, the underlying molecular mechanisms regulating RACK1 expression are unclear. In this study, we demonstrated that downregulated expression
Lei Zhang et al.
OncoTargets and therapy, 12, 1007-1020 (2019-02-19)
The expression and function of the Receptor for Activated C Kinase 1 (RACK1) in cancer growth and metastasis are confused in different cancers, especially in pancreatic ductal adenocarcinoma (PDAC). One-hundred and eighty-two PDAC tissue specimens (95 males and 87 females)
Wenting He et al.
Journal of Alzheimer's disease : JAD, 75(2), 451-460 (2020-04-07)
Accumulation of amyloid-β (Aβ) peptides, generated from amyloid-β precursor protein (AβPP) amyloidogenic processing, is one of the most salient disease hallmarks of Alzheimer's disease (AD). Nicotine is able to promote α-secretase-mediated AβPP nonamyloidogenic processing and increase the release of sAβPPα
Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Sujata Jha et al.
Nature, 546(7660), 651-655 (2017-06-22)
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service