Skip to Content
Merck
All Photos(1)

Key Documents

EHU096051

Sigma-Aldrich

MISSION® esiRNA

targeting human GCH1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTACTCGTCCATCCTGAGCTCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCGGCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGATGTCCTAAACGATGCTATATTTGATGAAGATCATGATGAGATGGTGATTGTGAAGGACATAGACATGTTTTCCATGTGTGAGCATCACTTGGTTCCATTTGTTGGAAAGGTCCATATTGGTTATCTTCCTAACAAGCAAGTCCTTGGCCTCAGCAAACTTGCGAGGATTGTAGAAATCTATAGTAGAAGACTACAAGTTCAGGAGCGCCTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jiao Xue et al.
The Journal of investigative dermatology, 137(10), 2059-2068 (2017-06-10)
Radiation-induced skin injury is a common side effect of radiotherapy and can limit the duration and dose of radiotherapy. Most early work focused on elimination of reactive oxygen species (ROS) after radiation; however, less is known about the mechanisms underlying
S Yuan et al.
European review for medical and pharmacological sciences, 23(11), 4564-4574 (2019-06-19)
To explore the effect of micro ribonucleic acid (miR)-124 on the spinal neuronal apoptosis and to explore its related mechanism. The rat model of spinal cord injury (SCI) was established, agomir-124 was injected intrathecally and the effect of agomir-124 on

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service