Skip to Content
Merck
All Photos(1)

Documents

EHU075391

Sigma-Aldrich

MISSION® esiRNA

targeting human GREM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAAGCCAAATCCAGGTGCACCCAGCATGTCCTAGGAATGCAGCCCCAGGAAGTCCCAGACCTAAAACAACCAGATTCTTACTTGGCTTAAACCTAGAGGCCAGAAGAACCCCCAGCTGCCTCCTGGCAGGAGCCTGCTTGTGCGTAGTTCGTGTGCATGAG

Ensembl | human accession no.

ENSG00000166923

NCBI accession no.

NM_013372

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GREM1(26585) , GREM1(26585)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Duo Li et al.
Molecular vision, 25, 625-635 (2019-11-09)
To investigate the role of Gremlin-1, which is an endogenous antagonist of the bone morphogenetic protein (BMP) signaling pathway, in inducing epithelium-mesenchymal transition (EMT) in fetal RPE cells after repeated wounds. Subconfluent repetitive passages in fetal RPE cells were regarded
Na Hui Kim et al.
Biochemical and biophysical research communications, 533(4), 1378-1384 (2020-10-25)
Gremlin-1 (GREM1), one of the antagonists of bone morphogenetic proteins (BMPs), has recently been reported to be overexpressed in a variety of cancers including breast cancer. GREM1 is involved in tumor promotion, but little is known about its role in
Kongzu Hu et al.
Molecular medicine reports, 15(4), 2186-2194 (2017-03-06)
Previous research focusing on rodent cells and animal models has demonstrated that gremlin-1 antagonizes bone morphogenetic proteins (BMPs) in order to suppress osteogenesis. However, the impact of gremlin‑1 on osteogenesis in human bone marrow-derived mesenchymal stem cells (MSCs) remains unknown.
Nam Ji Sung et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Gremlin-1 (GREM1), one of the bone morphogenetic protein (BMP) antagonists, can directly bind to BMPs. GREM1 is involved in organogenesis, tissue differentiation, and organ fibrosis. Recently, numerous studies have reported the oncogenic role of GREM1 in cancer. However, the role
Julie R Graham et al.
Journal of cellular biochemistry, 115(9), 1539-1548 (2014-03-19)
Fibrosis is a chronic disease characterized by an excessive deposition of scar tissue in the affected organs. A central mediator of this process is transforming growth factor-β (TGF-β), which stimulates the production of extracellular matrix proteins such as collagens. MicroRNAs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service