Skip to Content
Merck
All Photos(1)

Documents

EHU067451

Sigma-Aldrich

MISSION® esiRNA

targeting human MEN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCTGAGCCCATGTTCTGCCCCCAGCCCAAAGGGGACAGGCCTCACCTCTACCCAAACCCTAGGTTCCCGGTCCCGAGTACAGTCTGTATCAAACCCACGATTTTCTCCAGCTCAGAACCCAGGGCTCTGCCCCAGTCGTTAGAATATAGGTCTCTTCTCCCAGAATCCCAGCCGGCCAATGGAAACCTCACGCTGGGTCCTAATTACCAGTCTTTAAAGGCCCAGCCCCTAGAAACCCAAGCTCCTCCTCGGAACCGCTCACCTAGAGCCAGACCAACGTTACTCAGGGCTCCTCCCAGCTTGTAGGAGCTGAGGTTTCACCCTTAACCCAAGGAGCACAGGTCCCACCTCCAGCCCGGGAGCCTAGGACCACTCAGCCCCTAGGAGTATATTTCCGCACTTCAGAATTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Giulia Stefania Tavanti et al.
International journal of molecular sciences, 22(4) (2021-03-07)
The Hippo pathway is involved in human tumorigenesis and tissue repair. Here, we investigated the Hippo coactivator Yes-associated protein 1 (YAP1) and the kinase large tumor suppressor 1/2 (LATS1/2) in tumors of the parathyroid glands, which are almost invariably associated
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Laurent Ehrlich et al.
The American journal of pathology, 187(3), 570-580 (2017-01-15)
Menin (MEN1) is a tumor-suppressor protein in neuroendocrine tissue. Therefore, we tested the novel hypothesis that menin regulates cholangiocarcinoma proliferation. Menin and miR-24 expression levels were measured in the following intrahepatic and extrahepatic cholangiocarcinoma (CCA) cell lines, Mz-ChA-1, TFK-1, SG231

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service