Skip to Content
Merck
All Photos(1)

Key Documents

EHU056221

Sigma-Aldrich

MISSION® esiRNA

targeting human COPB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGTTCTGTCCGATTTCCAGATATGGCTGCAAATGTTATTCCTGTGTTAATGGAATTTCTCAGTGACAACAACGAAGCAGCAGCTGCTGATGTCTTGGAGTTTGTTCGTGAAGCCATTCAGCGCTTTGATAACCTGAGAATGCTTATTGTTGAGAAGATGCTTGAAGTCTTTCATGCTATTAAATCTGTCAAGATTTACCGAGGAGCATTATGGATCCTGGGAGAATACTGTAGTACCAAGGAAGACATTCAGAGTGTGATGACTGAGATCCGCAGGTCCCTTGGAGAGATCCCAATTGTAGAGTCAGAAATAAAGAAAGAAGCTGGTGAATTAAAACCTGAAGAAGAAATAACTGTAGGGCCAGTTCAGAAATTGGTTACTGAAATGGGTACCTATGCAACTCAGAGTGCCCTTAGCAGTTCTAGACCCACCAAGAAAGAGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Hiroki Kobayashi et al.
Biochemical and biophysical research communications, 467(1), 121-127 (2015-09-26)
Combining glycolytic inhibition with other anti-cancer therapies is a potential approach to treating cancer. In this context, we attempted to identify genes that determine sensitivity to 2-deoxyglucose (2DG), a glycolytic inhibitor, in cancer cells using pooled shRNA libraries targeting ∼15,000

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service