Skip to Content
Merck
All Photos(1)

Documents

EHU137921

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Ensembl | human accession no.

ENSG00000140575

NCBI accession no.

NM_003870

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IQGAP1(8826) , IQGAP1(8826)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shihong Su et al.
DNA and cell biology, 39(7), 1127-1140 (2020-05-05)
Pulmonary microvascular endothelium barrier plays a critical role in protecting the pulmonary tissue from inflammatory injury in acute respiratory distress syndrome and acute lung injury (ARDS/ALI). The dysregulation of IQ-GTPase-activating protein 1 (IQGAP1) was an important etiology of endothelium barrier
Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Aaron M Tocker et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2896-2909 (2017-09-03)
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers
Bhavna Chawla et al.
The Journal of biological chemistry, 292(8), 3273-3289 (2017-01-14)
Insulin binds to the insulin receptor (IR) and induces tyrosine phosphorylation of the receptor and insulin receptor substrate-1 (IRS-1), leading to activation of the PKB/Akt and MAPK/ERK pathways. IQGAP1 is a scaffold protein that interacts with multiple binding partners and
Ana C Alcalá et al.
The Journal of general virology, 98(8), 2088-2099 (2017-08-02)
Dengue virus NS1 is a glycoprotein of 46-50 kDa that is conserved among flaviviruses, associates as a dimer to cell membranes and is secreted as a hexamer to the extracellular milieu. Recent evidence showed that NS1 is secreted efficiently from infected
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service