Skip to Content
Merck
All Photos(1)

Key Documents

EHU001581

Sigma-Aldrich

MISSION® esiRNA

targeting human HBEGF

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAGAAGAGGGACCCATGTCTTCGGAAATACAAGGACTTCTGCATCCATGGAGAATGCAAATATGTGAAGGAGCTCCGGGCTCCCTCCTGCATCTGCCACCCGGGTTACCATGGAGAGAGGTGTCATGGGCTGAGCCTCCCAGTGGAAAATCGCTTATATACCTATGACCACACAACCATCCTGGCCGTGGTGGCTGTGGTGCTGTCATCTGTCTGTCTGCTGGTCATCGTGGGGCTTCTCATGTTTAGGTACCATAGGAGAGGAGGTTATGATGTGGAAAATGAAGAGAAAGTGAAGTTGGGCATGACTAATTCCCACTGAGAGAGACTTGTGCTCAAGGAATCGGCTGGGGACTGCTACCTCTGAGAAGACACAAGGTGATTTCAGACTGCAGAGGGGAAAGACTTCCATCTAGTCACAAAGACTCCTTCGTCCCCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Angela L Gaviglio et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(5), 1903-1915 (2017-02-09)
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF)
Karolin Ebert et al.
BMC cancer, 20(1), 1039-1039 (2020-10-30)
Gastric cancer is the fifth most frequently diagnosed cancer and the third leading cause of cancer death worldwide. The molecular mechanisms of action for anti-HER-family drugs in gastric cancer cells are incompletely understood. We compared the molecular effects of trastuzumab

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service