Skip to Content
Merck
All Photos(1)

Key Documents

EHU016511

Sigma-Aldrich

MISSION® esiRNA

targeting human CHN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenke Zhao et al.
Cancer medicine (2018-05-31)
It has been verified that long noncoding RNAs (lncRNAs) have great effects on various biological behaviors of human diseases. Although more and more lncRNAs have been studied in human cancers, countless lncRNAs still need to be excavated. This study aims
Zhuomin Wu et al.
Molecular neurobiology, 54(10), 7670-7685 (2016-11-16)
In recent years, long noncoding RNAs (lncRNAs) have been shown to have critical roles in a broad range of cell biological processes. However, the activities of lncRNAs during ischemic stroke remain largely unknown. In this study, we carried out a
Chunfeng Pan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 339-352 (2017-08-31)
Recently, long non-coding RNAs (lncRNAs) have been found to have many biological effects in different cancer stages. Several studies have revealed that focally amplified lncRNA on chromosome 1 (FAL1) regulates cancer progression via p21. However, the expression and mechanism of
Chingli Lee et al.
Scientific reports, 7, 43651-43651 (2017-03-08)
Fyn tyrosine kinase has been implicated in the pathogenesis of Alzheimer's disease (AD). We have previously reported that upregulation of the FynT isoform in AD brains was partly associated with astrocyte activation. In this study, we demonstrated selective FynT induction
Guang Yang et al.
Immunology, 153(1), 105-117 (2017-08-24)
The B-lymphocyte-induced maturation protein 1 (Blimp1) regulates T-cell homeostasis and function. Loss of Blimp1 could double the proportion of follicular regulatory T (Tfr) cells. However, the effects that Blimp1 may have on the function of Tfr cells remain unknown. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service