Skip to Content
Merck
All Photos(1)

Documents

EHU008631

Sigma-Aldrich

MISSION® esiRNA

targeting human USP37

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGTTCAGCACTCCATCATTTGTAAAGCATGTGGAGAGATTATCCCCAAAAGAGAACAGTTTAATGACCTCTCTATTGACCTTCCTCGTAGGAAAAAACCACTCCCTCCTCGTTCAATTCAAGATTCTCTTGATCTTTTCTTTAGGGCCGAAGAACTGGAGTATTCTTGTGAGAAGTGTGGTGGGAAGTGTGCTCTTGTCAGGCACAAATTTAACAGGCTTCCTAGGGTCCTCATTCTCCATTTGAAACGATATAGCTTCAATGTGGCTCTCTCGCTTAACAATAAGATTGGGCAGCAAGTCATCATTCCAAGATACCTGACCCTGTCATCTCATTGCACTGAAAATACAAAACCACCTTTTACCCTTGGTTGGAGTGCACATATGGCAATTTCTAGACCATTGAAAGCCTCTCAAATGGTGAATTCCTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Debjani Pal et al.
Cell death & disease, 11(4), 298-298 (2020-04-30)
APC/CCdh1 is a ubiquitin ligase with roles in numerous diverse processes, including control of cellular proliferation and multiple aspects of the DNA damage response. Precise regulation of APC/CCdh1 activity is central to efficient cell-cycle progression and cellular homeostasis. Here, we
Seok Kim et al.
Cancers, 11(3) (2019-03-14)
WP1130, a partially selective deubiquitinases (DUB) inhibitor, inhibits the deubiquitinating activities of USP5, USP9X, USP14, USP37, and UCHL1. In this study, we investigate whether WP1130 exerts sensitizing effect on TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in human renal carcinoma cells. Combinations
Zhenna Xiao et al.
American journal of cancer research, 9(12), 2749-2759 (2020-01-09)
SNAI1, an epithelial-mesenchymal transition (EMT)-inducing transcription factor, promotes tumor metastasis and resistance to apoptosis and chemotherapy. SNAI1 protein levels are tightly regulated by proteolytic ubiquitination. Here, we identified USP37 as a SNAI1 deubiquitinase that removes the polyubiquitination chain from SNAI1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service