Skip to Content
Merck
All Photos(1)

Key Documents

EHU073901

Sigma-Aldrich

MISSION® esiRNA

targeting human AXIN1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTCTGGTTTGCCTGCACTGGCTTCAGGAAGCTGGAGCCCTGTGACTCGAACGAGGAGAAGAGGCTGAAGCTGGCGAGAGCCATCTACCGAAAGTACATTCTTGATAACAATGGCATCGTGTCCCGGCAGACCAAGCCAGCCACCAAGAGCTTCATAAAGGGCTGCATCATGAAGCAGCTGATCGATCCTGCCATGTTTGACCAGGCCCAGACCGAAATCCAGGCCACTATGGAGGAAAACACCTATCCCTCCTTCCTTAAGTCTGATATTTATTTGGAATATACGAGGACAGGCTCGGAGAGCCCCAAAGTCTGTAGTGACCAGAGCTCTGGGTCAGGGACAGGGAAGGGCATATCTGGATACCTGCCGACCTTAAATGAAGATGAGGAATGGAAGTGTGACCAGG

Ensembl | human accession no.

ENSG00000103126

NCBI accession no.

NM_181050

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AXIN1(8312) , AXIN1(8312)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Chen et al.
PloS one, 10(7), e0133115-e0133115 (2015-07-24)
During development, scaffold proteins serve as important platforms for orchestrating signaling complexes to transduce extracellular stimuli into intracellular responses that regulate dendritic spine morphology and function. Axin ("axis inhibitor") is a key scaffold protein in canonical Wnt signaling that interacts
Yongjuan Zhang et al.
Biochemical and biophysical research communications, 513(1), 261-268 (2019-04-08)
Caveolin-1 has been reported to play an important role in the pathogenesis of acute respiratory distress syndrome (ARDS). This study was designed to identify Caveolin-1-interacting proteins to reveal the molecular mechanisms of ARDS. Yeast two-hybrid screening was performed using Caveolin-1
Shiwei Zhou et al.
Pharmaceutics, 13(3) (2021-04-04)
Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic
Hae-Kyung Lee et al.
Oncogene, 37(31), 4273-4286 (2018-05-02)
The adenomatous polyposis coli (APC) protein has a tumor-suppressor function by acting as a negative regulator of the Wnt signaling pathway. While its role as a tumor suppressor is well-defined, the post-translational modifications that regulate APC stability are not fully
Dongshao Chen et al.
Cancer management and research, 11, 1349-1362 (2019-02-28)
Characterized by elevated AFP levels in serum, AFP-producing gastric cancer (APGC) is a very special type of gastric cancer (GC) that is difficult to treat and has poor prognosis. However, little is known about the role of AFP in GC
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service