HSTUD1491
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-4484
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Code UNSPSC :
12352200
Nomenclature NACRES :
NA.51
Gamme de produits
MISSION®
Forme
solid
Séquence mature
AAAAGGCGGGAGAAGCCCCA
Numéro d'accès Sanger mature/mineur
Numéro d'accès Sanger microARN
Température de stockage
−20°C
Description générale
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Autres remarques
Based on miRBase V19
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Mention d'avertissement
Warning
Mentions de danger
Conseils de prudence
Classification des risques
STOT RE 2 Inhalation
Organes cibles
Respiratory Tract
Code de la classe de stockage
11 - Combustible Solids
Classe de danger pour l'eau (WGK)
WGK 3
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Faites votre choix parmi les versions les plus récentes :
Certificats d'analyse (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
Si vous avez besoin d'assistance, veuillez contacter Service Clients
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique