Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

HSTUD0162

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-129-2-3p

Synonyme(s) :

hsa-miR-129-3p

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
12352200
Nomenclature NACRES :
NA.51

Gamme de produits

MISSION®

Forme

solid

Séquence mature

AAGCCCUUACCCCAAAAAGCAU

Numéro d'accès Sanger mature/mineur

Numéro d'accès Sanger microARN

Température de stockage

−20°C

Description générale

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Autres remarques

Based on miRBase V19

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Pictogrammes

Health hazard

Mention d'avertissement

Warning

Mentions de danger

Conseils de prudence

Classification des risques

STOT RE 2 Inhalation

Organes cibles

Respiratory Tract

Code de la classe de stockage

11 - Combustible Solids

Classe de danger pour l'eau (WGK)

WGK 3

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mukul Godbole et al.
Cancer biology & therapy, 18(10), 801-805 (2017-09-07)
Hormonal therapy is an important component of first line of treatment for breast cancer. Response to hormonal therapy is influenced by the progesterone receptor (PR)-status of breast cancer patients. However as an early effect, exposure to progesterone decreases expression of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique