Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU198551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arf1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCACCTGCATTCCATAGCATTGTGCTTGTACTTGTGCTCACACGGTTACCTAGGGTAGGCTGGGAGCCATTGTGGGGTGCAGGGCCTGGCTTGTACTTGGTGTGTGCAAGGCCCAATGGCAGCCTGCATACCCAGCCTACTCTTGGGCCCACTTGGACGCGCTGGCAGGAGGCCTGGGTCTCACCAGCAGGAGTGCGTGCAAGGTGGGAGGGTCGGTCCATTACAGACCCACATCCTGGAGCACCCCCATCTCCATGTGTGAAGTAGCTTCCTCCCTCAGCCTGCAAGGGTCCGATTTGCCATCGAAAGACGACCTCTACTTTTTTCTTTTGTATTTTGATAAACACTGAAGAAGCTGGAGCTGTTAAATTTATCTTGGGGAAATCTCAGAACTGGTTTATTTGGTGTCGTGGAACCTCTTACCGCTTTCAATACACAATTAGTAATCAACTGTTTTGTATACTTGTTTTCAGTTTTCATTTCGACAAGCACTGTAATTATAGCTGTTA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique