Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU178411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGACCGTGGCTAAACCTGCAGGATCTTTAGCCAGAAGCAGTAGTTTATGCCGCTCTCGTCGCAGCATCGTGCCATCCTCCCCACAGTCTCAGCGAGCTCAGCTTCCTGCTCATGCTCCTCTGGCAGCCCACCCTCGGCACCCTCACCATCCGCAGCATCCCCAGCACTCGTTGCCTTCCCCAGATCCAGACATCCTGTCTGTGTCAAGTTGCCCTGCTCTGTATCGGAACGAAGAGGAGGAGGAGGCTATCTACTTCACTGCTGAGAAACAATGGGAAGTGCCAGACACAGCTTCAGAATGTGACTCCTTAAACTCTTCCAGTGGGAGAAAACCGTCTCCCCCTTCAAGCCTTGAGATGTACCAAACATTGTCTTCCCGAAAAATCTCAAGAGACGAGCTTTCCCTGGAGGACTCTTCCAGGGGGGAGTCACCCGTGACAGCAGATGTCTCCCGGGGCTCCCCTGAGTGTGTGGGTCTGACGGAGACCAAGAGCATGATCTTCAGCCCTGCAAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
Ruby A Fernandez et al.
American journal of physiology. Cell physiology, 308(8), C581-C593 (2015-02-13)
Pulmonary arterial hypertension (PAH) is a progressive disease that, if left untreated, eventually leads to right heart failure and death. Elevated pulmonary arterial pressure (PAP) in patients with PAH is mainly caused by an increase in pulmonary vascular resistance (PVR).
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique