Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU177661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Insr

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGCAGATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCTGCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCATCCGAGGCTCCCGTCTCTTCTTCAACTATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATGAACATCACCCGGGGCTCTGTCCGCATCGAGAAGAATAATGAGCTCTGCTACCTGGCCACTATCGACTGGTCCCGTATCCTGGATTCTGTGGAGGACAACTACATTGTACTGAACAAAGATGACAACGAGGAATGTGGGGATGTCTGTCCAGGCACCGCCAAGGGCAAGACCAACTGTCCTGCCACTGTCATCAATGGGCAGTTTGTGGAACGGTGCTGGACACACAGTCATTGTCAGAAAGTTTGCCCAACCATCTGTAAGTCACATGGCTGCACAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Ingrit Hamann et al.
Archives of biochemistry and biophysics, 558, 42-50 (2014-06-17)
Copper ions are known to induce insulin-like effects in various cell lines, stimulating the phosphoinositide 3'-kinase (PI3K)/Akt signaling cascade and leading to the phosphorylation of downstream targets, including FoxO transcription factors. The aim of this work was to study the
Isabel Heidegger et al.
Oncotarget, 5(9), 2723-2735 (2014-05-09)
We scrutinized the effect of insulin receptor (INSR) in addition to IGF1R in PCa using in vitro and in vivo models. In-vitro overexpression of IGF1R and INSRA, but not INSRB increased cell proliferation, colony formation, migration, invasion and resistance to

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique