Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU149921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Esrrg

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGCTCTCTGTATTCTGTGGACAGTCTTATTCTATGTACACAGATGTAATTAAAGTTGTACTCCTAACAAACAAAAGAATAGTTCAGCTTCAATGTTCCATGTTTGCTGCGCTTTTCTGAACTTTATGTTGCATTCAGAAACTGTCGTCTTGTTCTCGTGGTGTTTGGATTCTTGTGGTGTGTGCTTTTAGACACAGGGTAGAATTAGAGACAGTATTGGATGTATACTTCCTCAGGAGACTACAGTAGTATATTCTACTCCTTACCAGTAATAACTAAGAGATTGAAACTCCAAAACAGTATTCATTACGATCAGACACACATCAAAATCATAATAATATTTTCAAAAAAGGGATAATTTCTCTAATGGTTTATTATAGAATACCAATGTATAGCTTAGACATAAAACTTTGAATATTCAAGAATATAGATAAGTCTAATTTTTAAATGCTGTATATAAGGCTTCCACCTGATCATCTCTCAGATGTTGTTATTAACTCGCTCTGTGT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jiao Meng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 11460-11473 (2021-01-08)
Lycium barbarum berry (gouqi, Goji, goji berry, or wolfberry), a traditional medicine and functional food, has a wide range of biological effects, including immuno-modulation, anti-aging, antitumor, neuro-protection, and hepato-protection. However, thus far, little is known about the traditional effects of
Bo Yuan et al.
Cancer science, 106(7), 819-824 (2015-05-06)
Hepatocellular carcinoma (HCC) is among the leading causes of cancer-related death in China. Deregulation of microRNA (miRNA) contributes to HCC development by influencing cell growth, apoptosis, migration or invasion. It has been proved that miR-940 plays important roles in various

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique