Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU095351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stmn1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCCACAAAATGGAGGCTAACAAAGAGAACCGGGAGGCGCAGATGGCGGCCAAGCTGGAGCGCTTGCGAGAGAAGGACAAGCACGTGGAAGAGGTGCGGAAGAACAAAGAATCCAAAGACCCCGCGGATGAGACTGAGGCTGACTAAGTTGTCCCGAGAACTGACTTTCTCCCCGACCCCGTCCTAAATATCCAAAGACTGTACTGGCCAGTGTCCTTTACTTTCCCTCCTGACAGATAGTCTAGAAGCCGATGTAGGACCGTATAGGTAGATCCAGACCGTGAGATGTTTTAGGGGCTCAAGGGGAGAAACTGAAAGTGTTTTACTCTTTTTTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTCGTTGCATCTTTTCCACTCGGGCACAATCGGTGTGCTGGGTTAATGGCTAGTACTGTATTGACTGTGGAAGACGTTTGTGAAGAGTATGTAGTGGCTTCTTCCAACCCATTAGATGCTGAATATCTGTCCACTTTGCGATCCCAATTCT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
W Feng et al.
Cancer gene therapy, 22(3), 115-121 (2015-01-13)
Paclitaxel (PTX) is broadly considered the drug of choice for treating human esophageal squamous cell cancer (ESCC). However, PTX resistance often ultimately leads to treatment failure. stathmin, or Op18, is a ubiquitously expressed 19-kDa cytosolic phosphoprotein that can integrate various
Kimberly A Birnie et al.
Molecular cancer research : MCR, 13(7), 1106-1118 (2015-04-01)
Malignant pleural mesothelioma (MPM) is often fatal, and studies have revealed that aberrant miRNAs contribute to MPM development and aggressiveness. Here, a screen of miRNAs identified reduced levels of miR-223 in MPM patient specimens. Interestingly, miR-223 targets Stathmin (STMN1), a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique