Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU093981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bmi1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAATCTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAGGACTGTTAAGGAAAAGATTTTTCAACCCCCTGATTTAGTTACCTTCATTCATTACAGCTTTATAGATGCTTAATACATGTGACTGTCGTCCAGTTTGCTTCCTTTTGTAGTGACTTTAAATTTGGCCATAAATGATGGACTAGATGTGATACTTCATATGGATGTTAAGTGGAAAGATTGATTCTTTCTCTAAAGAATTGGATTCTGAGAAGGATTCTGTGTTAGGAAAGATGTGAAATGATTTCTGTGACCACTGTTTGGATCTGGAAATGTTCTACAGTGGGTAGACATTGGGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Boyang Chang et al.
Biochimica et biophysica acta, 1840(12), 3285-3291 (2014-08-26)
Bmi-1 had been found to involve in self renewal of stem cells and tumorigenesis in various malignancies. In this study, we investigated the role of Bmi-1 in the development of salivary adenoid cystic carcinoma (SACC). At first, we confirmed that
Dan Xiong et al.
Cancer biology & therapy, 16(5), 756-763 (2015-04-17)
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we
Lei Liu et al.
International journal of clinical and experimental pathology, 8(6), 6674-6682 (2015-08-12)
The aim of this study was to evaluate the efficiency of a targeted siRNA nano-delivery system to silence the expression of Bmi-1 and hTERT, and to verify the toxicity of this delivery system in MCF-7 breast cancer cells. The most
F Wei et al.
Oncogene, 34(23), 3063-3075 (2014-08-05)
The BMI1 protein contributes to stem cell pluripotency and oncogenesis via multiple functions, including its newly identified role in DNA damage response (DDR). Although evidence clearly demonstrates that BMI1 facilitates the repair of double-stranded breaks via homologous recombination (HR), it

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique