Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU092801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sfrs3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAATCACAAGCCGTCTCGATCCTTCTCTAGGTCTCGTAGCCGATCTAGGTCAAATGAAAGGAAATAGAAGACCAGTTTGCAAAAGTGGTGTACAGGAAATAACTTCATCTGACAGGAGTATGTACAGGAAATTAAAGTTTTGTTTGAGACTTCATAAGCTTGGTGCATTTTTAAGATGGTTTAGCTGTTTAAATTTGTTTTGTCTCTTGGAACAGTGACACACAAAACAATGTAATTCTCTATGGTTTTCAGATGGATCATAAGAGGCACGTGATATCAAGAATTGTTACTTTACAATGTTCCCTTAAGCAAGATTTAATTTTCTTTGAATTTTAGTTTTTCATAGACTGAAATAAACCTTAGGTCCTGCCCAGTTTTAAGTGTGATGTACTAATGATATAAAGCAACTGGCGGAAATTGAAAGAAGCTATAGTCCTCTAGTAGCTGAGACACTGTGGCACTGTGGGTGGAATGATAAAGCGGTGTTTAAGAGCTGCTGTGAACACAAGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

S Zhu et al.
Oncogene, 35(14), 1847-1856 (2015-06-30)
CD44E is a frequently overexpressed variant of CD44 in gastric cancer. Mechanisms that regulate CD44 splicing and expression in gastric cancer remain unknown. Herein, we investigated the role of DARPP-32 (dopamine and cyclic adenosine monophosphate-regulated phosphoprotein, Mr 32000) in promoting
Rong Jia et al.
International journal of biological sciences, 6(7), 806-826 (2010-12-24)
Tumor cells display a different profile of gene expression than their normal counterparts. Perturbations in the levels of cellular splicing factors can alter gene expression, potentially leading to tumorigenesis. We found that splicing factor SRp20 (SFRS3) is highly expressed in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique