Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU089501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hspa4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAGAAGGAACGGAATGACGCCAAGAATGCTGTGGAAGAGTATGTGTATGAGATGAGAGACAAACTTAGTGGTGAATATGAGAAGTTTGTGAGTGAAGATGATCGTAATACTTTTACCTTAAAATTAGAGGATACTGAAAATTGGCTGTATGAAGATGGAGAAGATCAACCAAAGCAAGTTTATGTAGACAAATTGGCTGAATTAAAAAGTTTAGGTCAACCCATTAAGACACGGTTCCAGGAATCTGAAGAAAGACCAAAATTATTTGAAGAACTAGGGAAGCAAATCCAACAGTATATGAAAGTGATCAGCTCTTTCAAAAACAAGGAGGACCAGTATGAACACTTGGATGCTGCTGACGTGACAAAGGTAGAGAAAAGCACCAATGAGGCGATGGAGTGGATGAATAGCAAGCTTAACCTGCAGAACAAACAGAGCCTGACGGTGGATCCAGTTGTCAAGACAAAGGAGATTGAAGCTAAAATTAAGGAGCTGACAAGTATTTGCAGTCCTATAATTTCAAAACCCAAACCCAAAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Kanika Jain et al.
Cell stress & chaperones, 19(6), 801-812 (2014-03-05)
The fall in ambient oxygen pressure in high-altitude milieu elicits a wide range of physiological responses in the myocardium, which may differ from individual to individual. This condition, known as hypobaric hypoxia, invokes the cardioprotective heat shock response. The present
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique