Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU072881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse 1190002h23rik

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGCCACTTCCACTATGAGGAGCACCTAGAGCGCATGAAGCGGCGCAGCAGCGCCAGCATCAGCAACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGACTCAGTGTACAGGGACAGCTTCACCTTCAGTGATGAGAAGCTGAATTCTCCAACCAACTCCTCTCCAGCTCTCCTGCCCTCCGCTGTCACTCCTCGGAAAGCCAAATTAGGTGACACTAAAGAGCTCGAAGACTTCATTGCCGATCTGGACAGGACCTTAGCAAGTATGTGAAGCAAGGAGTTTGGGGTCCAGAAGGCTCCGAGGACCTGGCAAATCGGCTACTAGAATCTGCTGTGGAAGAGAGCAGAGCTAAGACTCCTGCCCCCTGACCATTCTTAGTTCACTATAACATTAGCCATTGGGCCCATCTCTGGGCAGTTCGGAGAGTGAAGCT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

ACTRIMS-ECTRIMS MSBoston 2014: Poster Sessions 2.
Multiple sclerosis (Houndmills, Basingstoke, England), 20(1 Suppl), 285-496 (2014-09-11)
Ran Xu et al.
Molecular and cellular biochemistry, 394(1-2), 109-118 (2014-05-17)
Response gene to complement 32 (RGC32) is a novel protein originally identified as a cell cycle activator and has been demonstrated to be overexpressed in a variety of human malignancies, including lung cancer. However, the potential role of RGC32 in
Peng Zhao et al.
Cellular & molecular immunology, 12(6), 692-699 (2014-11-25)
Response gene to complement 32 (RGC-32) is a cell cycle regulator involved in the proliferation, differentiation and migration of cells and has also been implicated in angiogenesis. Here we show that RGC-32 expression in macrophages is induced by IL-4 and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique