Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU067621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTCCCCAGCTAGTCCTCCTGGGAGTCTTGAGCCAAAGGCAGCAAGGCTCCCTCCTATGCGCAGAGAGAGTGGCCGCCCAATCAAACCCCCACGAAAAGACTTGCCTGACTCGCAACAGCAACACCAGAGCTCTAAGAAAGGGAAGCTGTCAGAGCAGTTAAAGCACTGCAACGGCATCCTGAAGGAACTGCTCTCAAAGAAGCACGCTGCCTACGCCTGGCCCTTCTATAAGCCAGTGGACGCTTCTGCTCTTGGCCTTCATGATTACCATGACATCATTAAACACCCCATGGACCTCAGCACTGTCAAGCGGAAGATGGAGAACCGTGACTACCGGGATGCACAGGAGTTTGCTGCTGATGTACGGCTTATGTTCTCCAACTGCTATAAGTACAATCCTCCAGACCACGATGTTGTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kun Zang et al.
PloS one, 8(10), e78536-e78536 (2013-11-07)
Bromodomain-containing protein 2 (Brd2) is a nuclear serine/threonine kinase involved in transcriptional regulation. In 3T3-L1 adipocytes, Brd2 normally co-represses PPARγ (peroxisome proliferator-activated receptor gamma) and inhibits adipogenesis. Here, we show that Brd2 over-expression in preadipocytes inhibits their differentiation into adipocytes
Chiara Pastori et al.
Epigenetics, 9(4), 611-620 (2014-02-06)
Epigenetic proteins have recently emerged as novel anticancer targets. Among these, bromodomain and extra terminal domain (BET) proteins recognize lysine-acetylated histones, thereby regulating gene expression. Newly described small molecules that inhibit BET proteins BRD2, BRD3, and BRD4 reduce proliferation of
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Chang Soon Choi et al.
Neurochemical research, 40(11), 2211-2219 (2015-09-10)
The post translational modification of lysine acetylation is a key mechanism that regulates chromatin structure. Epigenetic readers, such as the BET domains, are responsible for reading histone lysine acetylation which is a hallmark of open chromatin structure, further providing a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique