Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU054211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTCGCGTGGATAAGGAGTTCTCTGGTGTGCCCTGGAACTCACACGACATCTTCCAGTACCAAGACAAAGCCTATTTCTGCCATGGCAAATTCTTCTGGCGTGTGAGTTTCCAAAATGAGGTGAACAAGGTGGACCATGAGGTGAACCAGGTGGACGACGTGGGCTACGTGACCTACGACCTCCTGCAGTGCCCTTGAACTAGGGCTCCTTCTTTGCTTCAACCGTGCAGTGCAAGTCTCTAGAGACCACCACCACCACCACCACACACAAACCCCATCCGAGGGAAAGGTGCTAGCTGGCCAGGTACAGACTGGTGATCTCTTCTAGAGACTGGGAAGGAGTGGAGGCAGGCAGGGCTCTCTCTGCCCACCGTCCTTTCTTGTTGGACTGTTTCTAATAAACACGGATCCCCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shan Lu et al.
Journal of cellular physiology, 230(8), 1862-1870 (2014-12-30)
MicroRNA-520c (miR-520c) and microRNA-373 (miR-373) are originally characterized as both oncogenes and tumor suppressors in different types of human cancers. In this study, we found that translation of mRNA of MT1-MMP, an oncogene related to tumor metastasis, was well inhibited
Pauli Puolakkainen et al.
Medical oncology (Northwood, London, England), 31(3), 884-884 (2014-02-15)
Patients with chronic pancreatitis with local inflammation have high risk for pancreatic cancer. The aim of this study was to examine the role of the inflammatory cells in the invasion of pancreatic cancer cells, focusing on the involvement of a
Ming-Ju Hsieh et al.
British journal of pharmacology, 171(12), 3037-3050 (2014-03-20)
High mortality and morbidity rates for hepatocellular carcinoma in Taiwan primarily result from uncontrolled tumour metastasis. Glabridin, a prenylated isoflavonoid of licorice (Glycyrrhiza glabra) roots, is associated with a wide range of biological properties, such as regulation of energy metabolism, oestrogenic
Yang Yu et al.
Biochemical and biophysical research communications, 463(3), 285-291 (2015-05-25)
Preeclampsia is a devastating pregnancy-related syndrome characterized by the onset of hypertension, proteinuria and edema. Insufficient invasion of trophoblasts is well-known to be correlated with preeclampsia development. The present study was performed to investigate the functional role microRNA (miRNA)-204 in
Hongmei Yu et al.
Experimental cell research, 333(1), 127-135 (2015-02-24)
Mucus hypersecretion is the key manifestation in patients with chronic inflammatory airway diseases and mucin 5AC (MUC5AC) is a major component of airway mucus. Matrix metalloproteinases (MMP)-9, have been found to be involved in the pathogenesis of inflammatory airway diseases.

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique