Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU047871

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGCCACGGTACTTCCTTCTGAAGAGTGATGGATCTTTCATTGGGTATAAGGAGAGGCCCGAGGCCCCTGACCAGACCTTACCCCCCCTGAACAATTTCTCTGTAGCAGAATGCCAGCTGATGAAGACTGAGAGGCCACGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCATGTAGACTCTCCAGATGAGAGGGAAGAGTGGATGCGGGCTATCCAGATGGTCGCCAACAGTCTGAAGCAGCGGGGCCCAGGTGAGGACGCCATGGATTACAAGTGTGGCTCCCCCAGTGACTCTTCCACATCTGAGATGATGGAGGTAGCTGTCAACAAGGCACGGGCCAAAGTGACCATGAATGACTTCGATTATCTCAAACTCCTCGGCAAG

Numéro d'accès Ensembl | souris

ENSMUSG00000004056

Numéro d'accès NCBI

NP_001103678

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... AKT2(11652) , Akt2(11652)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
Samir Attoub et al.
Scientific reports, 5, 12759-12759 (2015-08-04)
The Akt/PKB serine/threonine protein kinase consists of three isoforms: Akt-1, -2 and -3. Their overexpression has been detected in human cancers, but their roles in cancer progression are unclear. We investigated the impact of specific silencing of Akt1 and Akt2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique