Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU047431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGAAGCGAAGATCCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAAGCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGAGGCCCAGGAGTCAGGGTTATTCTTTGGCTAATGGGGAGTTTAAGGAAAGAGGCATCAATCTGCAGAGTGGAGAAAGTGGGGGTAAGGGTGGGTTGCGTGGGTAGCTTGCACTGCCGTGTCTCAGGCCGGGGTTCCCAGTGTCACCCTGTCTTTCCTTGGAGGGAAGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wensen Ding et al.
International journal of clinical and experimental pathology, 13(5), 1136-1145 (2020-06-09)
As an evolutionarily conserved RNA-binding protein, LIN28 is known to be involved in the regulation of the translation and stability of a large number of mRNAs and the biogenesis of certain miRNAs. Increasing evidence indicates that LIN28 regulates many cellular
Qian Li et al.
Experimental cell research, 388(1), 111718-111718 (2019-12-25)
Successful implantation happens only when the development of a competent blastocyst synchronized with the differentiation of a receptive uterus. The exact mechanism affecting embryo implantation competency is still unclear. Previous data from our laboratory showed that several members of the
Jinzhuo Dou et al.
Molecular oncology, 14(9), 2288-2312 (2020-04-26)
LIN28A is a conserved RNA-binding protein that inhibits the biogenesis of let-7 microRNAs, thus promoting cancer progression. However, mechanisms underlying the activation of the LIN28A-let-7 signaling pathway remain poorly understood. Here, we show that LIN28A is SUMOylated in vivo and in vitro

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique