Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU043861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGAAGGCTGTGTTCTTCGCAGGGAATGAGTACTGGGTCTATTCTGCTAGTACTCTGGAGCGAGGATACCCCAAGCCACTGACCAGCCTGGGGTTGCCCCCTGATGTCCAGCAAGTAGATGCTGCCTTTAACTGGAGTAAGAACAAGAAGACATACATCTTTGCAGGAGACAAGTTCTGGAGATACAATGAAGTGAAGAAGAAAATGGACCCCGGTTTCCCTAAGCTCATCGCAGACTCCTGGAATGCCATCCCTGATAACCTGGATGCCGTCGTGGACCTGCAGGGTGGTGGTCATAGCTACTTCTTCAAGGGTGCTTATTACCTGAAGCTGGAGAACCAAAGTCTCAAGAGCGTGAAGTTTGGAAGCATCAAATCAGACTGGCTGGGCTGCTGAGCTGGCCCTGTTCCCACGGGCCCTATCATCTTCATCGCTGCACACCAGGTGAAGGATGTGAAGCAGCCTGGCGGCTCTGTCCTCCTCTGTAGTTAACCAGCCTTCTCCTTCACCTGGTGACTTCAGATTTAAGAGGGTGGCTTCTTTTTGTGCCCAAAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yijing Chu et al.
Experimental cell research, 337(1), 16-27 (2015-07-26)
Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal
Irina Gradinaru et al.
PloS one, 10(11), e0142787-e0142787 (2015-11-17)
α1a Adrenergic receptors (α1aARs) are the predominant AR subtype in human vascular smooth muscle cells (SMCs). α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular
Eric A Voll et al.
Oncotarget, 5(9), 2648-2663 (2014-05-07)
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27)
Suping Yang et al.
Molecular medicine reports, 12(5), 6990-6996 (2015-09-10)
Prostate cancer (PCa) is the second leading cause of cancer‑related mortality among American males. Studies suggest that cigarette smoking is associated with the progression of PCa; however, the molecular mechanisms underlying this process have not been extensively investigated. PCa progression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique