Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU036141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ruvbl2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGTGGCTGAGTGGAGAGAGGAGGGCAAGGCAGAGATCATTCCTGGGGTGCTGTTCATCGACGAGGTCCACATGCTGGACATTGAGAGTTTCTCTTTCCTCAACCGGGCCCTGGAGAGCGACATGGCGCCTGTCCTCATCATGGCCACCAACCGAGGGATCACCCGGATCCGAGGCACCAGCTACCAGAGTCCCCACGGCATCCCCATCGACCTGCTGGACCGCTTGCTCATTGTATCAACGTCACCCTACAGTGAGAAGGATACCAAGCAGATTCTGCGCATCCGCTGTGAGGAGGAAGATGTGGAGATGAGTGAGGACGCCTACACAGTGCTGACCCGCATTGGGCTCGAGACCTCCCTGCGCTATGCCATCCAGCTCATCACAGCGGCCAGCCTGGTGTGCCGGAAACGAAAGGGCACCGAGGTGCAGGTCGATGACATTAAGCGTGTATACTCCCTCTTCCTGGATGAATCCCGCTCCACACAGTAC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjuan Li et al.
Molecular cancer, 9, 132-132 (2010-06-01)
Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER) stability and is aberrantly expressed in certain cancers. Given its role in
Mathieu Dalvai et al.
PLoS genetics, 9(4), e1003387-e1003387 (2013-05-03)
Histone variants, including histone H2A.Z, are incorporated into specific genomic sites and participate in transcription regulation. The role of H2A.Z at these sites remains poorly characterized. Our study investigates changes in the chromatin environment at the Cyclin D1 gene (CCND1)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique